html - How can I force a long string without any blank to be wrapped?

Question

I have a long string (a DNA sequence). It does not contain any whitespace character.

For example:

ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA

What would be the CSS selector to force this text to be wrapped in a html:textarea or in a xul:textbox?

Answer 1

for block elements:

<textarea style="width:100px; word-wrap:break-word;">
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</textarea>